View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_456 (Length: 242)
Name: NF10954A_low_456
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_456 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 19506528 - 19506319
Alignment:
| Q |
17 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506528 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacctacgtgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
19506429 |
T |
 |
| Q |
117 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506428 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
19506329 |
T |
 |
| Q |
217 |
gttatgttat |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
19506328 |
gttatgttat |
19506319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 36194208 - 36194326
Alignment:
| Q |
38 |
tatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatggccactagcattgcattcacca |
137 |
Q |
| |
|
||||||| ||| || | |||||| |||||||||||||||| | |||| | |||||||||||||||| ||||| ||||||| ||||||||| |||| |
|
|
| T |
36194208 |
tatctcaatgggtttctaacagaggaacccacatgatataccc---catctctaggttgatttgcatgagccaccatagccactaacattgcattgacca |
36194304 |
T |
 |
| Q |
138 |
ccatatcagcagggatctgctt |
159 |
Q |
| |
|
|||| ||||| || |||||||| |
|
|
| T |
36194305 |
ccatgtcagctggtatctgctt |
36194326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University