View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_463 (Length: 241)
Name: NF10954A_low_463
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_463 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 240
Target Start/End: Complemental strand, 23333986 - 23333750
Alignment:
| Q |
4 |
gtaagattggaggtgggcggggtgctctttgcaaggcacggaggctgtaaccaaaacagccattgaagttgggtgtgactcatgaagcggacaataaggt |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333986 |
gtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgcaaccaaaacagccattgaagttgggtgtgactcatgaagcggacaataaggt |
23333887 |
T |
|
| Q |
104 |
tgtctatctgaagcatgttccttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtactcccc |
203 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23333886 |
tgtctatctgaagcatcttcgttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactcccc |
23333787 |
T |
|
| Q |
204 |
caaagaggttgataagtttgttttatgtaattttttg |
240 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333786 |
ccaagaggttgataagtttgttttatgtaattttttg |
23333750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University