View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_467 (Length: 241)
Name: NF10954A_low_467
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_467 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 21140116 - 21140286
Alignment:
| Q |
19 |
tcaggtatcaattagatcattgctatatgactaattgtactatatactcaaaaaattacacnnnnnnngtactattcatacatcccaaaggccttcnnnn |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
21140116 |
tcaggtatcaataagatcattgctatatgactaattgtactacatactcagaaaattacactttttttgcactattcatacatcccaaaggccttc-ttt |
21140214 |
T |
|
| Q |
119 |
nnnaattttgattaagaaaattacactttaactccctcttgtgtcctaaacatagagggaagtagtttttgcc |
191 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||| | || |||||||||| |
|
|
| T |
21140215 |
tttaattttgattaagaaaattacac-ttaactccctcttgtgtcctaaacatggagcggaggagtttttgcc |
21140286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University