View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_485 (Length: 238)
Name: NF10954A_low_485
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_485 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 233
Target Start/End: Original strand, 18260096 - 18260325
Alignment:
| Q |
5 |
agcatctggagttttagggatcaagataagagagtttgcattgtagttgggaaggagcgatccagtcttgaagaattctaccacagcttcatacacatct |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260096 |
agcatatggagttttagggatcaagataagagagtttgcattgtagttgggaaggagccatccagtcttgaagaattctaccacagcttcatacacatct |
18260195 |
T |
|
| Q |
105 |
ttctgaactatatcccaataggtttggaaaaagcaagcaccaaa-ccatgaggccctggtgcaccatcatgattcaaataaaaaatagcatttttaactt |
203 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260196 |
ttcttaactatattccaataggtttggaaaaagcaagcaccaaacccatgaggccctggtgcaccatcatgattcaaataaaaaatagcatttttaactt |
18260295 |
T |
|
| Q |
204 |
cacttggattaggaatactagtgggaatct |
233 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
18260296 |
cacttggattaggaatattagtgggaatct |
18260325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University