View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_493 (Length: 237)
Name: NF10954A_low_493
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_493 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 5 - 237
Target Start/End: Original strand, 30841247 - 30841480
Alignment:
| Q |
5 |
tgagatggacatcacatctttacccaaaaccttnnnnnnntaggtttatgagtaatcttatttataagtgctctaccttcacttttctaagtaatgt-at |
103 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||| ||||||||||||| |||||||||||||||| || ||||||||||||||||||||||| || |
|
|
| T |
30841247 |
tgagttggacaccgcatctttacccaaaaccttaaaaaaataggtttatgagtcatcttatttataagtgttcaaccttcacttttctaagtaatgttat |
30841346 |
T |
|
| Q |
104 |
acttctaagtctaactcatacttgcaacttccaactcacgcttgttacacaacaatctactctccaggtgtgagctcatcaattcatcatactccccgtc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30841347 |
acttctaagtctaactcatacttgcaacttccaactcacggttgttacactacaatcttctctccaggtgtaagctcatcaattcatcataccccccgtc |
30841446 |
T |
|
| Q |
204 |
aaacataaactttttcttccacttacacttactt |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
30841447 |
aaacataaactttttcatccacttacacttactt |
30841480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University