View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_496 (Length: 236)
Name: NF10954A_low_496
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_496 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 23840619 - 23840431
Alignment:
| Q |
20 |
cgattttggtcgaaattcatcgatgacaaggtaacnnnnnnnc--agtgtcttttttagtctttgtacttcgtataacgggttgtctttgtgttgcgatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | ||||||||| | |||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
23840619 |
cgattttggtcgaaattcatcgatgacaaggtaacttcttcttttagtattttttttagtatatgtacttcctataacacgttgtcttcgtgttgcgatc |
23840520 |
T |
 |
| Q |
118 |
cttaatattgtgtagaatcgcgattagatataactgatgcaaccgttatgtcacagcctacatagctgtcataaatctttatttaaacc |
206 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| ||| ||||||||| || |||||||||||||| |
|
|
| T |
23840519 |
cttaatattgcgtagaatcgcggttagatataactgatgcaaccattatgtcacaagctagatagctgtcgcaagtctttatttaaacc |
23840431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 23861270 - 23861237
Alignment:
| Q |
20 |
cgattttggtcgaaattcatcgatgacaaggtaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23861270 |
cgattttggtcgaaattcatcgatgacaaggtaa |
23861237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 23844067 - 23844033
Alignment:
| Q |
20 |
cgattttggtcgaaattcatcgatgacaaggtaac |
54 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23844067 |
cgattttggtcaaaattcatcgatgacaaggtaac |
23844033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University