View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_496 (Length: 236)

Name: NF10954A_low_496
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_496
NF10954A_low_496
[»] chr7 (3 HSPs)
chr7 (20-206)||(23840431-23840619)
chr7 (20-53)||(23861237-23861270)
chr7 (20-54)||(23844033-23844067)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 23840619 - 23840431
Alignment:
20 cgattttggtcgaaattcatcgatgacaaggtaacnnnnnnnc--agtgtcttttttagtctttgtacttcgtataacgggttgtctttgtgttgcgatc 117  Q
    |||||||||||||||||||||||||||||||||||          ||| | ||||||||| | |||||||| ||||||  |||||||| |||||||||||    
23840619 cgattttggtcgaaattcatcgatgacaaggtaacttcttcttttagtattttttttagtatatgtacttcctataacacgttgtcttcgtgttgcgatc 23840520  T
118 cttaatattgtgtagaatcgcgattagatataactgatgcaaccgttatgtcacagcctacatagctgtcataaatctttatttaaacc 206  Q
    |||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||  ||| |||||||||  || ||||||||||||||    
23840519 cttaatattgcgtagaatcgcggttagatataactgatgcaaccattatgtcacaagctagatagctgtcgcaagtctttatttaaacc 23840431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 23861270 - 23861237
Alignment:
20 cgattttggtcgaaattcatcgatgacaaggtaa 53  Q
    ||||||||||||||||||||||||||||||||||    
23861270 cgattttggtcgaaattcatcgatgacaaggtaa 23861237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 23844067 - 23844033
Alignment:
20 cgattttggtcgaaattcatcgatgacaaggtaac 54  Q
    ||||||||||| |||||||||||||||||||||||    
23844067 cgattttggtcaaaattcatcgatgacaaggtaac 23844033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University