View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_498 (Length: 236)
Name: NF10954A_low_498
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_498 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 29189091 - 29188862
Alignment:
| Q |
1 |
gaaccgtgtatgtatggaaaaggttatgtctgtagctggaaagaatccggttattcttaatgag--tcagtttatttctaagctagctgatcagctgaat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29189091 |
gaaccgtgtatgtatggaaaaggttatgtctatagctggaaagaatccggttattcttaatgagagtcagtttatttctaagctagctgatcagctgaat |
29188992 |
T |
|
| Q |
99 |
gcagagattgttctcggtacagttcaaaatgtgaaggaaacccgcctatggattcggcaaacttacacgtatgtctgtatgttaacgaatcattcttcat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29188991 |
gcagagattgttctcggtacagttcaaaatgtgaaggaagcccgcctatggattcggcacacttacacgtatgtctgtatgttaacgaatccttcttcat |
29188892 |
T |
|
| Q |
199 |
atggtttagcagaagatgttatagctaaag |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
29188891 |
atggtttagcagcagatgttatagctaaag |
29188862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 66 - 129
Target Start/End: Original strand, 29263729 - 29263792
Alignment:
| Q |
66 |
cagtttatttctaagctagctgatcagctgaatgcagagattgttctcggtacagttcaaaatg |
129 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29263729 |
cagtttatttccaagctggctgatcagctgaatgcagagattgttctcggtacagttcagaatg |
29263792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 66 - 137
Target Start/End: Original strand, 2796216 - 2796287
Alignment:
| Q |
66 |
cagtttatttctaagctagctgatcagctgaatgcagagattgttctcggtacagttcaaaatgtgaaggaa |
137 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||| || |||||||||||||| |||||||||| ||||||| |
|
|
| T |
2796216 |
cagtttatttccaagctggccgatcagctgaatgcggaaattgttctcggtaccgttcaaaatgcgaaggaa |
2796287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University