View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_506 (Length: 235)
Name: NF10954A_low_506
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_506 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 22837144 - 22837351
Alignment:
| Q |
10 |
gatggacatcaaatccatggacacattccaaatataaacctgtcttacctccaagactttaatgtctctggtaacaacctctctggtagagtacctgaat |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837144 |
gatggaaatcaaatccatggacacattccaaatataaacctgtcttacctccaagacttcaatgtctctggtaacaacctctctggtagagtacctgaat |
22837243 |
T |
|
| Q |
110 |
tactttcgggttttcctgattcatcttttgctcaaaacccgtctttatgtggcgctccattgcaaaaatgtaaagacgttcctgcccttgcttcgtcgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22837244 |
tactttcgggttttcctgattcatcttttgctcaaaacccgtctttatgtggtgctccattgcaaaaatgtaaagacgttcctgcccttgcttcatcgtt |
22837343 |
T |
|
| Q |
210 |
ggttccat |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
22837344 |
ggttccat |
22837351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University