View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_513 (Length: 234)
Name: NF10954A_low_513
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_513 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 42601595 - 42601815
Alignment:
| Q |
15 |
attttgtcacaatgtatcaaattagtttctcacattatgtacatttcaagatgattcattaaattgcaattaaattcacccatccgtttaacattaagtt |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42601595 |
attttgtcacattgtatcaaattagtttctcacattatgtacatttcaaaatgattcattaaattgcaattaaattcacccatccgtttaacattaagtt |
42601694 |
T |
|
| Q |
115 |
ggtaatttctgagatgtatct-aaattattatgtaaacgagatgcatttgatagcaaaataaaaagttgttgctgtttttcactcaaacttccaatccaa |
213 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
42601695 |
ggtaatttctgagatgtatttgaaattattatgtaaacgagatgcatttgatagcaaaataaaaagatgttgctgtttttcactcaaactcccaatccaa |
42601794 |
T |
|
| Q |
214 |
acccttccaagtttctgtatt |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42601795 |
acccttccaagtttctgtatt |
42601815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University