View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_519 (Length: 233)
Name: NF10954A_low_519
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_519 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 213
Target Start/End: Original strand, 2337190 - 2337378
Alignment:
| Q |
25 |
acatcaaaatctacaaaattggagagaaggcacgggaatggggagatattacatactcttggatatacttcttagaatttgttgggtcaggaatccaatg |
124 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2337190 |
acatcaaaatctacaaaactggagagaaggcacgggaatgaggagatatgacatactcttggatatacttcttaggatttgttgggtcaggaatccaatg |
2337289 |
T |
 |
| Q |
125 |
aatctcactcatgtttggtgtctcaacgtaggacatagtaaattcccctatcttctcaagctttcctctcttacctgcccttagtataa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2337290 |
aatctcactcatgtttggtgtctcaacgtaggacatagtaaattctcctatcttctcaagctttcctctcttacctgcccttagaataa |
2337378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University