View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_520 (Length: 233)
Name: NF10954A_low_520
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_520 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 41957922 - 41957823
Alignment:
| Q |
9 |
gacatcaggatatgataagttaatgttgaatattattccattttgccactttagattaaattttatttctgaatgagagttgcgttaactaaccagatag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
41957922 |
gacatcaggatatgataagttaatgttgaatattattccattttgccactttagtttaaattttatttctgaatgagagctctgttaactaaccagatag |
41957823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 41957756 - 41957715
Alignment:
| Q |
173 |
catatctatcattcttttttaagaaccataacgtgattttga |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41957756 |
catatccatcattcttttttaagaaccataacgtgattttga |
41957715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University