View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_524 (Length: 231)
Name: NF10954A_low_524
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_524 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 15867508 - 15867303
Alignment:
| Q |
16 |
acatcacaatcaagttccgtacatggtctcttatacctttctcggtgacaatggatgaagtactgaacatactgcgcttacggtaaaagatgcacctgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15867508 |
acatcacaatcaagttccgtacatggtctcttatacctttctcggtgacaatggatgaagtactgaacatactgcgcttacggtaaaagatgcacctgag |
15867409 |
T |
|
| Q |
116 |
tgactaaaggctcgaactctgatgtatgaattcaacactcccatcttgttgtaacacagagagttgttcatataccttaccatctctgagtcccccatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15867408 |
tgactaaaggctcgaactctgatgtatgaattcaacactcccatcttgttgtaacacagagagttgttcaaataccttaccatctctgagtcccccatat |
15867309 |
T |
|
| Q |
216 |
tcttcg |
221 |
Q |
| |
|
| |||| |
|
|
| T |
15867308 |
ttttcg |
15867303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University