View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_537 (Length: 230)
Name: NF10954A_low_537
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_537 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 177 - 225
Target Start/End: Complemental strand, 5155621 - 5155573
Alignment:
| Q |
177 |
aatggaaaataaaagcaggtcatggattgcagcaaaaagagggggatat |
225 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5155621 |
aatggaaaataaaagcatgtcatggattgcagcaaaaagagggggatat |
5155573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 81 - 143
Target Start/End: Complemental strand, 50328132 - 50328070
Alignment:
| Q |
81 |
ttatctatgcttcataagtaaaataacattttctttaaattaggatatgaaataaaataaaat |
143 |
Q |
| |
|
|||||||||||||| | |||||| ||| ||| || ||||||||| |||||||||||||||||| |
|
|
| T |
50328132 |
ttatctatgcttcaaatgtaaaacaacgtttgctctaaattaggttatgaaataaaataaaat |
50328070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 138
Target Start/End: Complemental strand, 50328246 - 50328189
Alignment:
| Q |
81 |
ttatctatgcttcataagtaaaataacattttctttaaattaggatatgaaataaaat |
138 |
Q |
| |
|
|||||||||||||| | |||||| ||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
50328246 |
ttatctatgcttcaaatgtaaaacaacgtttgctctaaattaggttatgaaataaaat |
50328189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 163
Target Start/End: Original strand, 9677318 - 9677380
Alignment:
| Q |
100 |
aaaataacattttctttaaattaggatatgaaataaaataaaataaactgtttgtgaaggtaga |
163 |
Q |
| |
|
||||||| |||| || ||||||||| |||||||||||||||| | || |||||||||||||||| |
|
|
| T |
9677318 |
aaaataaaatttgctctaaattaggttatgaaataaaataaact-aattgtttgtgaaggtaga |
9677380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University