View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_539 (Length: 230)
Name: NF10954A_low_539
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_539 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 22448992 - 22448761
Alignment:
| Q |
1 |
aagaacagcatctatccataggtaagttta--ccaagatataacatatgcaatcaagcgaacatgttaactactcgggcagtaaaggcaatctattgaag |
98 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22448992 |
aagaacagcacctatccataggtaagtttagtccaagatataacatatgcaatcaagcgaacatgttaactactcgggcagtaaaggcaatctattgaag |
22448893 |
T |
 |
| Q |
99 |
ttgttcagtgagccattagaactgccattggaggaggtaaaatcatcaaattcactttcatcatcgaactcagaagtttcactagttatcatttcatccg |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22448892 |
ttgttcagtgagccattggaactgccattggaggaggtaaaatcatcaaattcactttcatcatcgaactcagaagtttcactagttatcatttcatccg |
22448793 |
T |
 |
| Q |
199 |
acccataatgggatggcaggatgcgcagatga |
230 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
22448792 |
acccgtaatgggatggcaggatgcgcagatga |
22448761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University