View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_540 (Length: 230)
Name: NF10954A_low_540
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_540 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 12625123 - 12625353
Alignment:
| Q |
1 |
aaaaccgcaacttccatgttataattcggacttaatgcttgctctatatcaacaataaaatcgcttcgcctaacctcaactgtgacctctctccatggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12625123 |
aaaaccgcaacttccatgttataattcggacttaatgcttgctctatatcaacaataaaatcgcttcgcctaacctcaactgtgacctctctccatggta |
12625222 |
T |
 |
| Q |
101 |
gttgccgctccaccttgctattcagtcgacaaccaccgttaataggtcact-aacaaccttcctaccatcatcttggacaagtcaagtcacctcacacgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12625223 |
gttgccgctccaccttgctattcagtcgacaaccaccgttaataggtcactgaacaaccttcctaccatcatcttggacaagtcaagtcacctcgcacgg |
12625322 |
T |
 |
| Q |
200 |
atctaaaactaattatgttgttcttctatga |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
12625323 |
atctgaaactaattatgttgttcttctatga |
12625353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University