View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_545 (Length: 230)
Name: NF10954A_low_545
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_545 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 37195599 - 37195389
Alignment:
| Q |
1 |
atgtttgtagttactagttagccatctttttcttcttgatggtgaataactgaagatacataaaagtgagtgagcatattttgtcaaaaaatgaaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195599 |
atgtttgtagttactagttagccatctttttctt---gatggtgaataactgaagatacataaaagtgagtgagcatattttgtcaaaaaatgaaataaa |
37195503 |
T |
 |
| Q |
101 |
agttagcatatgactatgcttaatgttgatacgacctgatacgactggtattaaagatactgcctcctgctgttgggatatcttgttttcagtgtatcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195502 |
agttagcatatgactatgcttaatgttgata----------cgactggtattaaagatactgcctcctgctgttgggatatcttgttttcagtgtatcga |
37195413 |
T |
 |
| Q |
201 |
cgtttgttagatttagatcagaaa |
224 |
Q |
| |
|
||||||||||| ||| |||||||| |
|
|
| T |
37195412 |
cgtttgttagacttatatcagaaa |
37195389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University