View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_546 (Length: 230)
Name: NF10954A_low_546
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_546 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 31097633 - 31097404
Alignment:
| Q |
1 |
tgtgaggtggctggtctaatagtaatgatatttttatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgataaagn |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097633 |
tgtgaggtggctggtttaatagtaatgatatttttatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgataaagt |
31097534 |
T |
|
| Q |
101 |
nnnnnnnacttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097533 |
tttttttacttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaat |
31097434 |
T |
|
| Q |
201 |
catgatcagttgattgtgtggaactaatga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31097433 |
catgatcagttgattgtgtggaactaatga |
31097404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University