View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_548 (Length: 230)
Name: NF10954A_low_548
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_548 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 31470039 - 31470268
Alignment:
| Q |
1 |
aggacgataatgggttaggggcaactgttacagaccgaaccttgggatttcatgattcaataagtgatatatcaaaggccccagagcctccatctatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31470039 |
aggacgataatgggttaggggcaactgttacagaccgaaccttgggatttcatgatccaataagtgatatatcaaaggccccagagcctccatctatttt |
31470138 |
T |
|
| Q |
101 |
tgatatgtaggcgggaagaacatctcttgaaggcctttgaatgacacaatttggacgcattacagcacgaaacagggtaacttgatgaccctatctatca |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
31470139 |
tgatatgtaggcgggcagaacatctcttgaaggcctttgaacgacacaatttgggcgcattacagcacaaaacagggtaacttgatgaccccgtctatca |
31470238 |
T |
|
| Q |
201 |
tcgtatcaccaacggtcgttacgcctctga |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
31470239 |
tcgtatcaccaacggttgttacgcctctga |
31470268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 31487718 - 31487947
Alignment:
| Q |
1 |
aggacgataatgggttaggggcaactgttacagaccgaaccttgggatttcatgattcaataagtgatatatcaaaggccccagagcctccatctatttt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31487718 |
aggacgataatgggttagggtcaactgttatagaccgagccttgggatttcatgatccaataagtgatatatcaaaggccccagagcctccatctatttt |
31487817 |
T |
|
| Q |
101 |
tgatatgtaggcgggaagaacatctcttgaaggcctttgaatgacacaatttggacgcattacagcacgaaacagggtaacttgatgaccctatctatca |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
31487818 |
tgatatgtaggcgggcagaacatctcttgaaggcctttgaatgacataatttggacgcattacagtacgaaacagggtaacttgatgaccccatctatca |
31487917 |
T |
|
| Q |
201 |
tcgtatcaccaacggtcgttacgcctctga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31487918 |
tcgtatcaccaacggtcgttacgcctctga |
31487947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University