View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_549 (Length: 230)
Name: NF10954A_low_549
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_549 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 102 - 197
Target Start/End: Original strand, 40289892 - 40289987
Alignment:
| Q |
102 |
gtacatacacgttacatattctgttgcattcaaaatttcacgcttcttgtattatgcaattttaagttgcattctattttgtatatatcttttacc |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40289892 |
gtacatacacgttacatcttctgttgcattcaaaatttcacgcttcttgtattttgcaattttaagttgcattctattttgtatatatcttttacc |
40289987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 40289791 - 40289832
Alignment:
| Q |
1 |
aaagaatgtagaatgcattaatttgaattgtgtttgattatc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40289791 |
aaagaatgtagaatgcattaatttgaattgtgtttgattatc |
40289832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University