View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_551 (Length: 230)
Name: NF10954A_low_551
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_551 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 58 - 229
Target Start/End: Complemental strand, 29188580 - 29188409
Alignment:
| Q |
58 |
ccaattaatgtgtaattatttgattgattactaggttctttatgtatgtgattgttcttgtcatttctttgatttaagtagtagagttgcacgagaaaag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188580 |
ccaattaatgtgtaattatttgattgattactaggttctttatgtatgtgattgttcttgtcatttctttgatttaagtagtagagttgcacgagaaaag |
29188481 |
T |
|
| Q |
158 |
aaccaaatcttgtgtctttgagaattacctgctttagttctggtttatttattagtaggttcctttttggtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188480 |
aaccaaatcttgtgtctttgagaattacctgctttagttctggtttatttattagtaggttcctttttggtg |
29188409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 29188839 - 29188773
Alignment:
| Q |
1 |
tttggtaaatatctcactgctctaatttatctttaggtttttattacctgaactgaaccaattaatg |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
29188839 |
tttggtaaatatctcactgctctaatttatctttaggtttttattacctgaattgtaccaattaatg |
29188773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Original strand, 29264083 - 29264118
Alignment:
| Q |
173 |
ctttgagaattacctgctttagttctggtttattta |
208 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29264083 |
ctttgagaattacctgctttagttttggtttattta |
29264118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University