View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_557 (Length: 230)
Name: NF10954A_low_557
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_557 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 24781975 - 24782153
Alignment:
| Q |
15 |
gaaggaaagaaagtgaagaaatgcacttggggatctcaccggagataccgttccaatcagtgattgtaatgcttgaaagttgagttagcttacaaatctc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24781975 |
gaaggaaagaaagtgaagaaatgcacttggggatctcaccggagataccgttccaatcagtgattgtaatgcttgaaagtttagttagcttacaaatctc |
24782074 |
T |
 |
| Q |
115 |
cggggagatttgaccggtcatgtagccaggtttacgtgctttttcgaaggtggtgtagagagttccggcacggaggttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24782075 |
cggggagatttgaccggtcatgtagccaggtttacgtgctttttcgaaggtggtgtagagagttccggcacggaggttt |
24782153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University