View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_572 (Length: 229)
Name: NF10954A_low_572
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_572 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 36 - 221
Target Start/End: Original strand, 33262054 - 33262239
Alignment:
| Q |
36 |
ttgcaaccacagagtgccatgttggaagggccagcaattagtcatctgcaaccacaaactgccatattggaggggtcaacaatgactagtttgcaaccgc |
135 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262054 |
ttgctaccacagactgccatgttggaagggccatcaattagtaatctgcaaccacgaactgccatattggaggggtcaacaatgactagtttgcaaccgc |
33262153 |
T |
 |
| Q |
136 |
agaatgccacattgcaagggccagcaagtctgcctttcaacatcccaacttcagaagagctgagctcaatgattttgggtcattca |
221 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262154 |
agaatgccacactgcaagggccaacaagtctgcctttcaacatcccaatttcagaagagctgagctcaatgattttgggtcattca |
33262239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 33261974 - 33262025
Alignment:
| Q |
1 |
agagagcgatattgcaagggccagcgatgactgagttgcaaccacagagtgc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33261974 |
agagagcgatattgcaagggccagcgatgactgagttggaaccacagagtgc |
33262025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University