View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_579 (Length: 229)
Name: NF10954A_low_579
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_579 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 39718270 - 39718042
Alignment:
| Q |
1 |
atttagcatgattcagtgtttatcttttttgaggcctaagtatcttcaaaattggaatgttagtgaaatatatctattatagtacgtcgaagtggttcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718270 |
atttagcatgattcagtgtttatcttttttgaggcctaagtatcttcaaaattggaatgttagtgaaatatatctattatagtacgtcgaagtggttcag |
39718171 |
T |
|
| Q |
101 |
agacttacaataccctttacnnnnnnnnnnnnnnnnnctgctaatacctaatagttctttttggtttcgtccagaagcttggaatcttcatggagatgct |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
39718170 |
agacttacaataccctttacttttctttttcttttttctgctaatatctaatagttctttttggtttcttccagaagcttggaagcttcatggagatgct |
39718071 |
T |
|
| Q |
201 |
atttggcgggcgctatgtgattcttttga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39718070 |
atttggcgggcgctatgtgattcttttga |
39718042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 22549920 - 22549968
Alignment:
| Q |
181 |
ggaatcttcatggagatgctatttggcgggcgctatgtgattcttttga |
229 |
Q |
| |
|
|||| ||| ||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
22549920 |
ggaagctttatggagatgttatttggtgggcgctatgtgcttcttttga |
22549968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University