View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_583 (Length: 229)
Name: NF10954A_low_583
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_583 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 41103123 - 41102900
Alignment:
| Q |
1 |
atgttaaccgattttgaatcggcgattcagaaggaatcttcgaagattccggtcccgggcggaggaatccaccctctcacacgctatgccatgaactaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
41103123 |
atgttaaccgattttgaatcggcgattcagaaggaatcttcgaagattccggtaccaggcggaggaatccatcctctcacacgctatgtcatgaactaca |
41103024 |
T |
|
| Q |
101 |
tcgcacttctcgccgattacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103023 |
tcgcacttctcgccgattacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacga |
41102924 |
T |
|
| Q |
201 |
cgaggataatccaccgtcggagat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41102923 |
cgaggataatccaccgtcggagat |
41102900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University