View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_589 (Length: 229)
Name: NF10954A_low_589
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_589 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 38737467 - 38737704
Alignment:
| Q |
1 |
agtggtggtggtagcaacggcaagagttcccgtagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38737467 |
agtggtggtggtagcaacggcaagagttcccgtagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataag |
38737566 |
T |
|
| Q |
101 |
ttcnnnnnnnn---------ctctctctcttgtaatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttca |
191 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38737567 |
ttctttttttttttttttctctctctctcttgtaatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttca |
38737666 |
T |
|
| Q |
192 |
atttaacagatagataccgtcttttatttacagtttga |
229 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
38737667 |
atttaacaaatagatactgtcttttatttacagtttga |
38737704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University