View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_595 (Length: 228)
Name: NF10954A_low_595
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_595 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 3272198 - 3272419
Alignment:
| Q |
4 |
aaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctctttccctaaaaaccggagggttaacacaaannnnnnnnnnnn |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3272198 |
aaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctcttcccctaaaaaccggagggttaacacaattttttttttttt |
3272297 |
T |
|
| Q |
104 |
---gacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaagaaagcattttctttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3272298 |
tttgacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaagaaaccattttctttga |
3272397 |
T |
|
| Q |
201 |
agggagttttacattctgtttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3272398 |
agggagttttacattctgtttt |
3272419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University