View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_604 (Length: 228)
Name: NF10954A_low_604
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_604 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 2 - 228
Target Start/End: Original strand, 55315899 - 55316125
Alignment:
| Q |
2 |
cacattacaccaattgaggcaggactgacatgggctataggtaagaggagaagagcagaaggtggttttctaggagctgatgttatcttgaaacagctcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55315899 |
cacattacaccaattgaggcaggactgacatgggctataggtaagaggagaagagcagaaggtggttttctaggagctgatgttatcttgaaacagctcg |
55315998 |
T |
|
| Q |
102 |
cagatggtccttccataaggcgtgtcggtttcatttcatctggtccacctgctagaagccacagtgagattcaagatgaaggaggcaacaacattggtga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55315999 |
cagatggtccttccataaggcgtgtcggtttcatttcatctggtccacctgctagaagccacagtgagattcaagatgaaggaggcaacaacattggtga |
55316098 |
T |
|
| Q |
202 |
agtcactagtggtggattcagtccttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
55316099 |
agtcactagtggtggattcagtccttg |
55316125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University