View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_610 (Length: 227)
Name: NF10954A_low_610
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_610 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 215
Target Start/End: Original strand, 48231833 - 48232045
Alignment:
| Q |
3 |
atcggagccttctagtaaattctcaatctaaaaaaccaagggacagacaaaattataaagtgaaagtgagtgtcctgcattatctaactttttgcctttg |
102 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231833 |
atcggagccttatagcaaattctcaaactaaaaaaccaagggacagacaaaattataaagtgaaagtgagtgtcctgcattatctaactttttgcctttg |
48231932 |
T |
|
| Q |
103 |
acccatgtcacaagtattacagtaaccttatcttaaatgggtcattcttgatatatgtcagtatgcagacattgaaaatacaaactttttcatactatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231933 |
acccatgtcacaagtattacagtaaccttatcttaaatgggtcattcttgatatatgtcagtatgcagacattgaaaatacaaactttttcatactatct |
48232032 |
T |
|
| Q |
203 |
tgatggttatatt |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48232033 |
tgatggttatatt |
48232045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University