View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_62 (Length: 402)
Name: NF10954A_low_62
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 19 - 395
Target Start/End: Complemental strand, 52851235 - 52850860
Alignment:
| Q |
19 |
atataggtaggaagcatttactttaatttaatcactatcatcttacannnnnnnncaatgatagaacgaaacctagaagataaaagtagaagtaaactgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851235 |
atataggtaggaagcatttactttaatttaatcactatcatcttacatttcttttcaatgatagaacgaaacctagaagataaaagtagaagtaaactgc |
52851136 |
T |
|
| Q |
119 |
aacactaatttaaccgacctgagtttgaattgctgaaatgtcccctttttcccccctcaagctagctctattaaagggtagacattgtgtccttccaact |
218 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851135 |
aacactaatttaaccgacctgaatttaaattgctgaaatgtcccctttttccccc-tcaagctagctctattaaagggtagacattgtgtccttccaact |
52851037 |
T |
|
| Q |
219 |
aagggattttatgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcggccgtgttaataaaaccacccaactttgcaacaagc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52851036 |
aagggattttatgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcacccgtgttaataaaaccaaccaactttgcaacaagc |
52850937 |
T |
|
| Q |
319 |
gcagcactttctcttatgtggttcaaatctcttgtatccgtccatatgagccatgccaattgtatacttctgtgttt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850936 |
gcagcactttctcttatgtggttcaaatctcttgtatccgtccatatgagccatgccaattgtatacttctgtgttt |
52850860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University