View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_624 (Length: 225)
Name: NF10954A_low_624
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_624 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 37918193 - 37918222
Alignment:
| Q |
22 |
ggtgtgagtttagatgatgcatttttggag |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37918193 |
ggtgtgagtttagatgatgcatttttggag |
37918222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University