View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_628 (Length: 225)

Name: NF10954A_low_628
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_628
NF10954A_low_628
[»] chr4 (1 HSPs)
chr4 (16-204)||(32780935-32781123)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 32781123 - 32780935
Alignment:
16 catcatgaccgaaattcctggagcgggttgacgacaatggagaagccgtattcgtttctgttccaaggtagtctgcccatctagatggaccatcccattc 115  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
32781123 catcatgaccgaaattcctggagctggttgacgacaatggagaagccgtatttgtttctgttccaaggtagtctgcccatctagatggaccatcccattc 32781024  T
116 ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtct 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32781023 ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtct 32780935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University