View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_628 (Length: 225)
Name: NF10954A_low_628
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_628 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 32781123 - 32780935
Alignment:
| Q |
16 |
catcatgaccgaaattcctggagcgggttgacgacaatggagaagccgtattcgtttctgttccaaggtagtctgcccatctagatggaccatcccattc |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781123 |
catcatgaccgaaattcctggagctggttgacgacaatggagaagccgtatttgtttctgttccaaggtagtctgcccatctagatggaccatcccattc |
32781024 |
T |
 |
| Q |
116 |
ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781023 |
ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtct |
32780935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University