View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_637 (Length: 222)
Name: NF10954A_low_637
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_637 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 36172638 - 36172856
Alignment:
| Q |
1 |
agaataggtaatcatttgcaaaagatgtt-gtttttactcggttttatttgtccacttaagttcaattcattcatacattttctctgtacaatccttcag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172638 |
agaataggtaatcatttgcaaaagatgtttgtttttactcggttttattggtccacttaagttcaattcattcatacattttctctgtacaatccttcag |
36172737 |
T |
 |
| Q |
100 |
ctaattatgtgtggtcctgtcaaaaagaaaactaatttatgtgtggctaacgttccctctccctgcatgcttttgtgaatgaatgagacttcttcggtca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172738 |
ctaattatgtgtggtcctgtcaaaaagaaaactaatttatgtgtggctaaggttccctctccctgcatgcttttgtgaatgaatgagacttcttcggtca |
36172837 |
T |
 |
| Q |
200 |
taaagcattcatatcagtc |
218 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
36172838 |
taaagcattcatgtcagtc |
36172856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University