View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_638 (Length: 222)
Name: NF10954A_low_638
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_638 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 48623195 - 48622983
Alignment:
| Q |
1 |
atatactctttccccagactatattttttgtagaaaaaagtaaaagcttgggaaacttggtgtaaaaactatacgaatactttattctcatgcaatcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
48623195 |
atatactctttccccagactatattttttgtagaaaaaagaaaaagcttgggaaacttggtgtaaaaactatacgaatactttagtctcatgcattcaat |
48623096 |
T |
|
| Q |
101 |
gtaacgattattattatattccgacaaaataaataaaacgaagtttatcgggcatcaaacagattataaacggtatattgtggtagaagtgtaattcagt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48623095 |
gtaacgatta---ttatattccgacaaaataaataaaacgaagtttatcgtgcatcaaaccgattataaacagtatattgtggtagaagtgtaattcagt |
48622999 |
T |
|
| Q |
201 |
ttgttggagtagttta |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48622998 |
ttgttggagtagttta |
48622983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 216
Target Start/End: Complemental strand, 38653461 - 38653429
Alignment:
| Q |
184 |
tagaagtgtaattcagtttgttggagtagttta |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
38653461 |
tagaagtgtaattcagtttgttagagtagttta |
38653429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University