View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_650 (Length: 221)
Name: NF10954A_low_650
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_650 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 11610873 - 11610691
Alignment:
| Q |
20 |
tatttcaaaagaaaaatgaactaagacatatgataaagggaggtatcag-tcatatgacagtaaaccttgccgagtcgactaattatgtattgaaaggaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11610873 |
tatttcaaaagaaaaatgaactaagacatatgataaagggaggtatcaggtaatatgacagtaaaccttgccgagtcgactaattatgtattgaaaggaa |
11610774 |
T |
 |
| Q |
119 |
cacaaaaccttctaattacaatgttgattgaaggaacatatttagatttagtgaactatttgtaaggagaggacaacaaatag |
201 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11610773 |
cataaaaccttctaattacaatgttgattgaaggaacatatttagatttagtgaactatttgtaaggagaggacaacaaatag |
11610691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University