View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_655 (Length: 220)
Name: NF10954A_low_655
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_655 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 33650050 - 33649868
Alignment:
| Q |
20 |
ggaagatgcaattagagcttaaaattgaagtagtcattgttagacccaccaagatatgaaatttaaccgttggatcaaaatcggacgctaacgattttaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33650050 |
ggaagatgcaattagagcttaaaattgaagtagtcattgttagacccaccaagatatgaaatttaaccgttggatcaaaatcggacgctaacgattttaa |
33649951 |
T |
|
| Q |
120 |
actcggtattttagnnnnnnnnnnctttaaataatcaaatcatgtattgaaatttggatctatcaatctcatatccaaatatt |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33649950 |
actcggtattttagttttttttttctttaaataatcaaatcatgtattgaaatttggatctatcaatctcatatccaaatatt |
33649868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University