View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_66 (Length: 398)
Name: NF10954A_low_66
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 8700007 - 8699769
Alignment:
| Q |
1 |
gaactattatggattaactttgtaagcggttcaggcagcacctgaaattttattgcagtttttacttgatnnnnnnnnn-gttttaaataagtattttct |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||| | |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8700007 |
gaactattatggattaagtttgtaagcggttcaagcagctcttgaaattttattgcagtttttacttgataaaaaaaaaagttttaaataagtattttct |
8699908 |
T |
|
| Q |
100 |
attctatcctagaatacttaatgagatggtgaggaatctcctacaagtcttgatttcaaatctagaagagttttgtgattcattgtgatgccttacccga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8699907 |
attctatcctagaatacttaatgagatggtgaggaatctcctagaggtcttgatttcaaatctagaagagttttgtaattcattgtgatgccttacccga |
8699808 |
T |
|
| Q |
200 |
cttaaggaattagtctatacactttgcacaaagataccc |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
8699807 |
tttaaggaattagtttatacactttgcacagagataccc |
8699769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 129
Target Start/End: Original strand, 14382892 - 14382932
Alignment:
| Q |
89 |
aagtattttctattctatcctagaatacttaatgagatggt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
14382892 |
aagtattttctattctatcctaaaatacttaaagagatggt |
14382932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 52773596 - 52773527
Alignment:
| Q |
1 |
gaactattatggattaactttgtaagcggttcaggcagcacctgaaattttattgcagtttttacttgat |
70 |
Q |
| |
|
||||||||| ||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52773596 |
gaactattacggactaactttgtaagcggttgaggcagctcctgaaattttattgcagtttttacttgat |
52773527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University