View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_663 (Length: 219)
Name: NF10954A_low_663
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_663 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 22362307 - 22362100
Alignment:
| Q |
15 |
gattattctccgctcaaaatacctgatatcggcgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatct- |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22362307 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatatt |
22362208 |
T |
|
| Q |
114 |
--tgctgggttcttattcatcttttctttttcatgcgttgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagaatataccat |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22362207 |
gctgctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccat |
22362108 |
T |
|
| Q |
212 |
agtattaa |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
22362107 |
agtattaa |
22362100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University