View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_667 (Length: 218)
Name: NF10954A_low_667
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_667 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 43551937 - 43552117
Alignment:
| Q |
18 |
tgttgcatctgtgtacgtgattcatagtttgtaggctatctcgaatattcatatgatattaaacagctcaaattaaacaataacaaaatcatattcaac- |
116 |
Q |
| |
|
|||||| | ||||| |||| ||||||| ||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
43551937 |
tgttgcgtatgtgttcgtgcttcataggttgtaggttatctcgtatattcatatgatattaaacacctcaaattaaacaataacaaaatcagattcaatt |
43552036 |
T |
 |
| Q |
117 |
aattttaattgttaatttaagatcaaacggttgaaatttaaaatgcatgacaaattttacgaaattcaaatatgtaataaa |
197 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43552037 |
aattttaattgttaatttgagatcacacggttgaaatttaaaatgcatgacaaattttaccaaattcaaatatgtaataaa |
43552117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University