View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_669 (Length: 218)
Name: NF10954A_low_669
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_669 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 46421340 - 46421143
Alignment:
| Q |
20 |
atgaaccatatatcttttcttcaacatatgaaagaggaagatgaaggcttttcaggatatccggacttgcttctctggaggcagaaattgtcttcttcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46421340 |
atgaaccatatatcttttcttcaacatatgaaagaggaagatgaaggcttttcaggatatccagacttgcttctctggaggcagaaattgtcttcttcaa |
46421241 |
T |
|
| Q |
120 |
gacttgcctctgaagatattgcaagggacatattttctgtcggctgtctcttggcagaacttcatctttgcagaccgctattggatgtccatctcattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
46421240 |
gacttgcctctgaagatattgcaagggacatattttctgtcggctgtctcttggcagaacttcatctttgcagaccgctatttgat-tcaatctcattg |
46421143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University