View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_670 (Length: 218)
Name: NF10954A_low_670
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_670 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 40983478 - 40983276
Alignment:
| Q |
8 |
gatggacatcagttaccgtactaaagaagtccataccaaggacagcacatagatcatgcacagtactcacaaattcaaaaaccttttgcaacctgtcact |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983478 |
gatggacctcagttaccgtactaaagaagtccataccaaggacagcacatagatcatgcacagtactcacaaattcaaaaaccttttgcaacctgtcact |
40983379 |
T |
 |
| Q |
108 |
ctgccaaacaaagcaatgtaagaaaactgtcgatgcattgttaagtaaatgaaatcaaatggagttttcaaatctgtgattagataatatatttttggac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| | |||||| |
|
|
| T |
40983378 |
ctgccaaacaaagcaatgtaagaaaactgtcgatgcattgttaagtaaatgaaatcaaatggagttttcaaatctgcgactagatgatataatattggac |
40983279 |
T |
 |
| Q |
208 |
atg |
210 |
Q |
| |
|
||| |
|
|
| T |
40983278 |
atg |
40983276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University