View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_674 (Length: 217)

Name: NF10954A_low_674
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_674
NF10954A_low_674
[»] chr8 (1 HSPs)
chr8 (127-198)||(31504640-31504711)


Alignment Details
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 127 - 198
Target Start/End: Complemental strand, 31504711 - 31504640
Alignment:
127 aataatttttgaaaaatgataatcagtgtctccggaatattagttaaagaaattaaatttagtatgaatatt 198  Q
    ||||||||||||||||||||||| | || |   ||| |||||||||||||||||||||||||||||||||||    
31504711 aataatttttgaaaaatgataattattgcccttggagtattagttaaagaaattaaatttagtatgaatatt 31504640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University