View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_677 (Length: 216)
Name: NF10954A_low_677
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_677 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 32892062 - 32891866
Alignment:
| Q |
5 |
acatcaaagaacttggaatacaatgaagaacatcaaattgctgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892062 |
acatcaaagaacttggaatacaatgaagaacatcaaattgttgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
32891963 |
T |
|
| Q |
105 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagagacgcactctttggaacttttcgacgtctattgttgggtggggggat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891962 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggat |
32891866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University