View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_679 (Length: 216)
Name: NF10954A_low_679
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_679 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 56 - 198
Target Start/End: Original strand, 2856716 - 2856858
Alignment:
| Q |
56 |
ctttgctcaccgtcttcttcagaatcgaattgcaacaatagataacctattgtgcgaggtttacgtaaaaaatcaacaacttttatataggtggatgtgg |
155 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
2856716 |
ctttgctcaccgtcttcttcataatcgaattccaacaatatataatctattgtgcgaggtttacgtaaaaaatcaacaacttttatatgggtggttgtgg |
2856815 |
T |
 |
| Q |
156 |
atctcatgaggatagcaatcatttgtttttgcactgcgatttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2856816 |
atctcatgaggatagcaatcatttgtttttgcactgcgatttt |
2856858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University