View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_680 (Length: 215)
Name: NF10954A_low_680
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_680 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 50465730 - 50465550
Alignment:
| Q |
17 |
acatcaatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattacta-------attctttttagccattcacaaaca |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50465730 |
acatcgatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattactacttactaattctttttagccattcacaaaca |
50465631 |
T |
|
| Q |
110 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465630 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctct |
50465550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University