View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_693 (Length: 213)
Name: NF10954A_low_693
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_693 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 9520800 - 9520981
Alignment:
| Q |
13 |
acatcagaagtctctcctacattattctgcaacatcatttcatccttgttatcagctgcaatttcagagctcataaccttggtggggtcctccaattcct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9520800 |
acatcagaagtctctcctacattattctgcaacatcatttcatccttgttatcagctgcaatttcagagctcataactttggtggggtcctccaattcct |
9520899 |
T |
|
| Q |
113 |
gagctatcacagattgatctgccgagttcaattcagaggtaggattctgactactctgtgatccgttgataggattgcgtct |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9520900 |
gagctatcacagattgatctgtcgagttcaattcagaggtaggattctgactactctgcgatccgttgataggattgcgtct |
9520981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University