View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_702 (Length: 210)
Name: NF10954A_low_702
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_702 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 9436533 - 9436714
Alignment:
| Q |
16 |
acatcaacttaattgttttcttattatatctacattggtccccttcatcaatggccttgaaagctatcaactatgctaagatgctccatactaagatgct |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9436533 |
acattaacttaattgttttcttattatatctacattggtccccttcatcaatggccttgaaagctatcaactatgctaagatgctccatactaagatgct |
9436632 |
T |
 |
| Q |
116 |
tcaatgaaaaatacagacaacataaggaggcaacatatctgagatgcaaattcacaaatctgacggtttcttggatattgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
9436633 |
tcaatgaaaaatacagacaacataaggaggcaacatatctgagaagcaaattcacaaatttgacggcttcttggattttgtt |
9436714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University