View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_713 (Length: 209)
Name: NF10954A_low_713
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_713 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 42526107 - 42526290
Alignment:
| Q |
10 |
tcagcaatcatgccactcgcatatgcgcaaagattagttgagtaccatttttcttgtcatccatcccattcccccagacaacaagatagaaaaaacatac |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42526107 |
tcagcaatcatgcaactcgcatatgcgcaaagattatttgagtaccatttttcttgtcatccatcccattcccccagacagcaagatagaaaaaacatac |
42526206 |
T |
|
| Q |
110 |
acctttacatgttcaacgccaagcttcagccaactcggatcttgaatttattcgtccaataagagcaattcccctgttcttctc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42526207 |
acctttacatgttcaacgccaagcttcagccaactcggatcttgaatttattcgtccaataagagcaattcccctgttcttctc |
42526290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University