View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_715 (Length: 208)
Name: NF10954A_low_715
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_715 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 24622117 - 24622290
Alignment:
| Q |
21 |
attttggagtattttgttactactggtgttactgaagagtgatgttatggtcgtggattgcggttcggattacttggttggtcttggaagctatgatatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24622117 |
attttggagtattttgttactactggtgttactgaagagtgatgttatggttgtggattgcggttcggattacttggttggtcttggaagctatgatatt |
24622216 |
T |
|
| Q |
121 |
actggtcctgctgctgatgttaatttgatggggtatgctaaaacagaacaagttgcatctggtattcatttcag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24622217 |
actggtcctgctgctgatgttaatttgatggggtatgctaaaacagaacaagttgcatctggtattcatttcag |
24622290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 182
Target Start/End: Original strand, 42398543 - 42398634
Alignment:
| Q |
91 |
tacttggttggtcttggaagctatgatattactggtcctgctgctgatgttaatttgatggggtatgctaaaacagaacaagttgcatctgg |
182 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| ||||||||||| ||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
42398543 |
tacttggttggtcttggaagctatgacattaccggtcctgcagctgatgttaacatgatgggctatgctaacacagaacagattgcatctgg |
42398634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University