View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_716 (Length: 208)
Name: NF10954A_low_716
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_716 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 22 - 177
Target Start/End: Complemental strand, 43446769 - 43446614
Alignment:
| Q |
22 |
aagtgagttgtgaggtgggtgaggatagaaagtaaagcttaagaatcagagtgtatgaaaccatggaagcggtgtagaatcagaaatgaattgagttcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43446769 |
aagtgagttgtgaggtgggtgaggatagaaaataaagcttaagaatcagagtgtctgaaaccatggaagcggtgtagaatcagaaatgaatcgagttcaa |
43446670 |
T |
|
| Q |
122 |
tttgtttgtcgttggtacagattcactttttcactatagctaagagaagtgaagat |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43446669 |
tttgtttgtcgttggtacatattcactttttcactatagctaagagaagtgaagat |
43446614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University