View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_717 (Length: 208)
Name: NF10954A_low_717
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_717 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 31111204 - 31111374
Alignment:
| Q |
18 |
aatataaaatatatggctattgaacggtattgggaatcttattatcaatatcttaccccaaccaaaacccaatagaaaatcacaccaatgtgattaggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111204 |
aatataaaatatatggctattgaacggtattgggaatcttattatcaatatcttaccccaaccaaaacccaatagaaaatcacaccaatgtgattaggag |
31111303 |
T |
|
| Q |
118 |
acggggcacttttgtccctagcaatgtggcattgatgtggagtccacgtcaagtatcacatcttcatttag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111304 |
acggggcacttttgtccctagcaatgtggcattgatgtggagtccacgtcaagtatcacatcttcatttag |
31111374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 26006960 - 26006992
Alignment:
| Q |
155 |
tggagtccacgtcaagtatcacatcttcattta |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
26006960 |
tggagtccacgtcaagtgtcacatcttcattta |
26006992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University